Kleingesinds et al. 2015 (Conference Paper) Guzmania

Identification of diazotrophic bacteria associated with leaves of the epiphytic bromeliad Guzmania monostachia

Author(s):—Carolina Krebs Kleingesinds, Maria Aurineide Rodrigues, Marcos Pereira Marinho Aidar & Helenice Mercier in Benko-Iseppon, A.M.; Alves, M. & Louzada, R. (2015) An overview and abstracts of the First World Congress on Bromeliaceae Evolution. Rodriguésia 66(2): A1-A66.

Publication:— (2015).

Abstract:—Since epiphytic plants are subjected to intermittent supply of water and nutrients, association with microorganisms may be very important for the survival of these species. This study aimed to verify whethernitrogen-fixing (diazotrophic) bacteria are present in distinct leaf portions of the epiphytic-tank bromeliad Guzmania monostachia, and if they are in the exterior or interior of the leaves. Fully expanded leaves were collected from adult plants grown in both their natural environment (CE, Brazil) and in the greenhouse of the Laboratory of Plant Developmental Physiology (Biosciences Institute, University of São Paulo). All harvested leaf blades were sliced into three portions: basal (comprising the leaf sheath), middle, and apical (two halves of the remaining leaf blade). The plant material was sonicated to separate bacteria from the leaf surface (epiphytic bacteria). Subsequently, all leaf samples were submitted to an antiseptic procedure for finalmaceration and further investigation of bacteria present inside the plant tissues (endophytic bacteria). Four different media (NFb, JNFb, LGI e LGD) were used for bacterial growth. All these culture media are free of reduced nitrogen. Selection of diazotrophic bacteria was assessed by acetylene reduction assay (ARA). The isolates were identified by 16S rRNA and sequencing with the primer pair 27F (5? to 3? GAGAGTTTGATCCTGGCTCAG) and 1512R (5? to 3? TACGGTTACCTTGTTACGACTT). The results revealed two genera that are usually used in agriculture: Burkholdeira and Paenibacillus. The only culture medium which provided growth from both the natural habitat and the greenhouse was the JNFb. In addition, a higher number of ARA+ bacteria were isolated from the natural environment than the greenhouse and in both circumstances we found larger number of colonies in the basal portion. These results suggest that diazotrophic bacteria are located mainly in the base of G. monostachia leaves, where they might fix atmospheric nitrogen and provide it to this bromeliad mainly during periods of nutrient starvation.

Keywords:—Nitrogen-Fixing Bacteria; Bromeliaceae; 16s rRNA.